miRNA RT-qPCR Detection

List Grid

Set Descending Direction

1-10 of 733

Page:
  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  1. All-in-One™ miRNA qRT-PCR Detection Kit and validated miRNA primers
    0,00 €
    miRNA PCR analysis detection and profiling through RT-qPCR system validated miRNA primers Learn More
  2. All-in-One™ miRNA qRT-PCR Detection Kit*  (20 RT and 200 qPCR reactions)
    495,00 €
    Poly A Polymerase, RTase Mix, qPCR Mix, ROX Reference Dye, Universal Adaptor PCR Primer and other buffers (for use with miRNA qPCR primers) Learn More
  3. All-in-One™ miRNA qRT-PCR Detection Kit*  (60 RT and 600 qPCR reactions)
    1 135,00 €
    Poly A Polymerase, RTase Mix, qPCR Mix, ROX Reference Dye, Universal Adaptor PCR Primer and other buffers (for use with miRNA qPCR primers) Learn More
  4. All-in-One™ miRNA First-Strand cDNA Synthesis Kit  (20 RT reactions)
    395,00 €
    Poly A Polymerase, RTase Mix, PAP/RT buffer, spike-in control (for use with miRNA qPCR arrays) Learn More
  5. All-in-One™ miRNA First-Strand cDNA Synthesis Kit  (60 RT reactions)
    600,00 €
    Poly A Polymerase, RTase Mix, PAP/RT buffer, spike-in control (for use with miRNA qPCR arrays) Learn More
  6. All-in-One™ qPCR Mix  (20 µl x 200 qPCR reactions)
    340,00 €
    High-fidlity, hot-start DNA polymerase, optimized reaction buffer and dNTPs Learn More
  7. All-in-One™ qPCR Mix (20 µl x 600 qPCR reactions)
    495,00 €
    High-fidlity, hot-start DNA polymerase, optimized reaction buffer and dNTPs Learn More
  8. All-in-One™ qPCR Mix (1000 qPCR reactions)
    795,00 €
    High-fidlity, hot-start DNA polymerase, optimized reaction buffer and dNTPs Learn More
  9. All-in-One™ qPCR Mix (4000 qPCR reactions)
    1 995,00 €
    High-fidlity, hot-start DNA polymerase, optimized reaction buffer and dNTPs Learn More
  10. hsmq-0497 against hsa-miR-1229
    0,00 €
    hsmq-0497 against hsa-miR-1229 - MIMAT0005584 - 23b - CUCUCACCACUGCCCUCCCACAG Learn More

List Grid

Set Descending Direction

1-10 of 733

Page:
  1. 1
  2. 2
  3. 3
  4. 4
  5. 5