hsmq-0499 against hsa-miR-631

hsmq-0499 against hsa-miR-631
0,00 €

Availability: In stock

SKU : HmiRQP0741

hsmq-0499 against hsa-miR-631 - MIMAT0003300 - 21b - AGACCUGGCCCAGACCUCAGC
Description

Details

Cat. NoDescriptionSupplierApplicationPrice
HmiRQP0741hsmq-0499 against hsa-miR-631 - MIMAT0003300 - 21b - AGACCUGGCCCAGACCUCAGC GenecopoeiaRT-qPCR primer€118/£110
Reviews

Product Tags

Use spaces to separate tags. Use single quotes (') for phrases.