hsmq-0497 against hsa-miR-1229

hsmq-0497 against hsa-miR-1229
0,00 €

Availability: In stock

SKU : HmiRQP0066

hsmq-0497 against hsa-miR-1229 - MIMAT0005584 - 23b - CUCUCACCACUGCCCUCCCACAG
Description

Details

Cat. NoDescriptionSupplierApplicationPrice
HmiRQP0066hsmq-0497 against hsa-miR-1229 - MIMAT0005584 - 23b - CUCUCACCACUGCCCUCCCACAG GenecopoeiaRT-qPCR primer€118/£110
Reviews

Product Tags

Use spaces to separate tags. Use single quotes (') for phrases.